BidHits
BidHits

Ctg Government Bids & RFPs

Government bid alerts, regional filters, and fast access to documents

90% recommend BidHits (1091 real users, 08/28/2026). Methodology

USA | DC | DISTRICT OF COLUMBIA COUNTY | WASHINGTON

State, Department Of- State, Department Of- U. S. Embassy Bogota

CTG MAIL SCREENING PROJECT - Enclosed is a Request for Quotes ( RFQ) for CT Mail screening. If you would like to submit a quotation, follow the instructions in Section J of the solicitation. Site visit will be held on September 3, 2026 at 09: 00, if you are interested i

mail screening project

Bid Close Date:

Documents

07/28/2026 - USA | MD | MONTGOMERY COUNTY | SILVER SPRING | 20993 Small City

Dept Of Defense- Dept Of The Navy- Navsup- Navsup Other Hca- Bumed- Navy Medicine West- Naval Medical Research Center

Primers and probes - NAMRU SOUTH requests approval to award the purchase of primers and probes for protocol & ldquo; The Global Travelers Diarrhea ( GTD) Study: an evaluation of study design and laboratory methodologies standardization in a multisite protocol assessing t

Primers and probes for Global Travelers Diarrhea ( GTD) study 2 units hlt f ttc cca ccg gat cac caa, 2 units hlt r caa cct tgt ggt gca tga tga, 2 units lt pro 5 atto550n ctt gga gag aag aac cct mgbnfq, 2 units sth f gctaaaccagyagrgtcttcaaaa, 2 units sth r cccggtacargcaggattacaaca, 2 units sth pro 5sun tggtcctgaaagcatgaa 3mgbmgbnfq, 2 units stp f tgaatcacttgactcttcaaaa, 2 units stp r ggcaggattacaacaaagtt, 2 units stp pro 56fam tgaacaacacattttactgct 3mgb nfq, 2 units virb f gga ttt gtg caa cga ctt gtt aag, 2 units virb r gag gaa tct tgg ctt tga taa agg, 2 units virb pro 56fam cac tcc att ctg gta ata a mgbnfq, 2 units aggr 333f cag cga tac att aag acg cct aaa g, 2 units aggr 448 r cgt cag cat cag cta caa tta ttc c, 2 units aggr pro fam ctt gca gtt gtc cga att mgbnfq, 2 units eae f ccg att cct ctg gtg acg a, 2 units eae r cca cgg ttt atc aaa ctg ata acg, 2 units eae pro 5 atto550n icy3 cgt cat ggt acg ggt aa mgbnfq, 4 units bfpa fw ggt ctg tct ttg att gaa tct gca, 4 units bfpa rv gca gac tgg tag taa aac atc aca c

Bid Close Date:

Documents

07/23/2026 - USA | UT | DAVIS COUNTY | HILL AFB

Dept Of Defense- Dept Of The Air Force- Air Force Materiel Command- Air Force Life Cycle Management Center- Weapons- Fa8213 Aflcmc Ebhk

CAD/PAD Bombers FY27 Sources Sought - See attached document.

Cartridge and propellant actuated devices and components 1. Initiator, M26 2. EBW Initiator, parachute 3. Cartridge, engine starter 4. Elevon ordnance cartridge 5. ETRS Release Ring Assy. 6. Tank Assembly, Oxygen 7. EBW Initiator, Fuel Shut Off 8. Wing Ordnance Cartridge 9. Fin Ordnance Cartridge 10. ETRS Initiator 11. Thermal Battery BA648U 12. Thermal Battery BA648U 13. Initiator, M27 14. Time Delay, 0. 70 sec 15. TLX Line 16. Charge Assy, Linear RH 17. Charge Assy, Linear LH 18. CTG, Fire Extinguisher 19. Sensor Cabin Decompress 20. Output CTG, Aft Hatch 21. Input CTG, Aft Hatch 22. Time Delay, 1 sec 23. Time Delay, 3. 20 sec 24. Time Delay, 1. 60 sec 25. Time Delay, 2. 40 sec 26. CTG, Work Table Thruster 27. Output CTG, Fwd Hatch 28. Time Delay, 0. 30 sec 29. Input CTG, Fwd Hatch 30. Time Delay, 0. 70 sec 31. Handle, Hatch Jettison Type III 32. Input CTG, SRT 33. Time Delay, 0. 50 sec 34. SMDCGAS Type II Initiator 35. Selector Mode 36. Handle, Hatch Jettison 37. Initiator Propellant 38. SMDCGAS Type I Ini

Bid Close Date:

Documents
More bid opportunities are waiting for you!
Start your free 14-day trial to see all results and access the bid documents.
Start free trial

Get bid alerts running in 3 simple steps

  1. Tell us what you sell

    Add keywords for your products or services. Smart Search helps catch related opportunities beyond exact matches.

  2. Start the trial and receive alerts

    Use the 14-day free trial and get email alerts with documents or official posting links.

  3. Tune your feed

    Adjust keywords, regions, email schedule and email style. Use map view and filters when you want to explore.

User testimonials
We selected the most helpful reviews from real users. Order may change periodically.
It encompasses all portals in one place.
G. Ferrea
The tool is truly effective at scanning bid documents, efficiently delivering bids.
G. D. Reis
Excellent information. Just what I was looking for.
L. H. Borrelli
A very good platform.
D. C. Espinosa
I consistently received notifications about bids within the specific segment I chose to monitor. The system simplifies processes that used to be complex, offering a navigation experience that is easy, fast, and modern.
G. P. da S. E. Guimaraes
Fast, flexible, and simple.
E. Disruptivas
You see a lot of tenders; you get emails with the alerts.
M. Camarasa
It’s one of the best platforms for searching bids.
M. R. De Lima
The platform is very user-friendly.
N. Lobato
The idea of ​​using a keyword and sending the information by email is very good.
U. Solutions
Excellent platform to help promote and expand the reach of your work.
C. Merino
I like the way they provide information with the greatest possible accuracy. I love that.
M. A. Neil
The search tool really works and satisfactorily meets our needs.
D. L. Cairuga
Start free trial

Why use BidHits for government bidding

Start free trial

For teams and integrations

Send bid data into your CRM, BI or internal workflow via the Bid API, with JSON or XML output.
View API documentation

Frequently asked questions

BidHits is a government bid search engine that monitors official portals and brings relevant federal, state and local opportunities into one place. You can search on the site and receive scheduled email alerts.

Enter your email and activate the trial. For 14 days you can use the main features, including alerts and access to results. When it ends, if you do not subscribe at /subscription.php, the bid list becomes limited and you will not be charged automatically.

1) Add keywords that describe what you sell. 2) Start the trial. 3) Adjust regions, delivery times and email style after signup.

Whenever possible, yes. Some official portals require login or block direct links; in those cases we point you to the official process page so you can download the documents.

Yes. You can filter by region, procurement method, dates and value ranges. You can also save preferences for future alerts and searches.

Yes. In the dashboard you can see bids on a map and use it to plan follow-up by location.

It can happen. Smart Search uses your keywords to find related opportunities, not only exact matches. Add specific terms and remove off-topic results to improve future alerts.

Yes. You can query bids via API. Documentation at /api_integration.php. Ideal for CRM, BI and automations.

In Settings you can pause alerts or adjust delivery times. If you want to delete your account, just contact us. During the free trial there is no auto-charge.

We monitor major official sources every day at the federal, state and local levels. New bid notices are added as soon as they are captured from the source portal.

Plans start at $ 43.00 per month, with options for different business needs and billing terms. Start with a free trial and evaluate the results before subscribing, with no automatic billing.
Start free trial

See how it works

Start free trial

Add what you sell, get scheduled alerts, open documents or the official page, and use filters by region and method.

Transcript
Welcome to BidHits. Finding public tenders and bids is important. But what really matters is quickly identifying the opportunities that match what your company sells. To get started, enter a few keywords that describe your products or services. BidHits shows relevant opportunities, highlights your keywords, and organizes everything by date. Smart search is already enabled and uses artificial intelligence to expand your results, even when the tender uses different words from the ones you searched for. For each opportunity, you can view a summary, access documents, mark it as a favorite, add private notes, remove what is not relevant, or view it on the map. You can also use filters, run searches, and explore the day's opportunities directly on the map. Start using BidHits now. It's fast, practical, and you can try it for free.
AI Assistant
Ask me about the bid...
Loading summary...