BidHits uses cookies to provide an individualized service and care for the privacy and protection of shared data.
By browsing this site, we understand that you agree to the terms of our Privacy Policy.
Tga Government Bids & RFPs
Government bid alerts, regional filters, and fast access to documents
90% recommend BidHits (1084 real users, 08/13/2026).Methodology
66-- Thermogravimetry- Differential Scanning Calorim - IRA FUNDED - NOTICE: The U. S. Department of Energy ( DOE) National Energy Technology Laboratory ( NETL) is issuing the following Brand Name Exact Match Request for Quote ( RFQ) for a Mettler Toledo Laboratory Thermal Gravimetric Analyzer ( TGA) and Diff
The Department of Energy (DOE) National Energy Technology Laboratory (NETL) is issuing an RFQ for a Mettler Toledo TGA and DSC. This is a total small business set aside, and only quotes from small business concerns will be accepted. Selection will be based on the technically acceptable quotation with the lowest firm fixed price. All submissions and inquiries must be made electronically through the FedConnect portal.
Selection will be based on the small business quotation that is considered technically acceptable with the lowest firm fixed price quote.
The vendor shall be an approved and authorized reseller of the brand manufacturer as of the submission date of their quote.
Any quote that is submitted by a contractor that is not a small business concern will not be considered for award.
High- temperatureEnvironmental Thermogravimetric Analyzer - Themys LV compatible with steam injection including: The Themys LV microbalance ( capacity 100g, electronic resolutions 0. 02 /0. 2 ug, measuring range +/- **** mg with the TGA signal acquisition board)
High- temperature environmental thermogravimetric analyzer ( TGA) Themys LV microbalance ( capacity 100g, electronic resolutions 0. 02/0. 2 ug, measuring range +/- **** mg with TGA signal acquisition board), compatible with steam injection.
AI helper
Request for Proposal (RFP) for a high-temperature environmental thermogravimetric analyzer (TGA). Offers are due by August 11, 2026, 2:00 PM EST. The award will be made to the lowest-priced technically acceptable offer. Delivery terms are FOB destination duty paid. Payment terms are net 30 days upon final acceptance. Foreign national delivery drivers are not permitted onsite.
Partial delivery must be made on or before 09/24/2026. Deliveries are accepted Monday through Friday, from 7:00 a. m. to 3:00 p. m. local time. Partial delivery must be made on or before ****.
Payment terms are net 30 days upon final acceptance of the product/service. Payment terms are net 30 days upon final acceptance of the productservice.
The response must include the terms of warranty. Response must include the terms of warranty, technical support provisions and plans for shipment.
Award will be made to the responsible offeror submitting the lowest-priced offer that meets all specified requirements. Award resulting from this solicitation will be made to the responsible offeror submitting the lowest-priced offer that meets all specified requirements.
Offerors are expected to examine all instructions and provide sufficient detail to substantiate claims. Proposals must be technically feasible and achievable within allotted timeframes. The offerors proposal shall be prepared in accordance with the information provided in this rfp. specific responses to thebuyers requirements are necessary to enable the buyer to evaluate offerors understanding of, and capability toaccomplish the stated objectives.
Failure to comply with the requirement to coordinate all questions through the buyer's procurement organization may result in disqualification. Failure to comply with this requirement may result in the offerors disqualification from consideration for award.
VICI Tras Gas Analyzer - Synopsis: NASA/NSSC has a requirement for VICI Tras Gas Analyzer. NASA/NSSC intends to issue a sole source contract to VALCO INSTRUMENTS CO INC under the authority
Vici tras gas analyzer with external deoxo provision and Valco Instruments TGA install service 1. Vici tras gas analyzer with external deoxo provision ( OEM Part: ****). 2. Valco Instruments TGA install service ( OEM Part: TGAININSTALL).
AI helper
NASA NSSC requires a Vici tras gas analyzer with external deoxo provision and Valco Instruments TGA install service. This is a sole source contract intended for Valco Instruments Co Inc. The analyzer is a 7u chassis unit with specific detectors and software for automated operation and data acquisition. The installation service includes onsite training and setup. Performance will be at NASA Kennedy Space Center, FL. Interested organizations must submit capabilities by 3:00 p. m. CST on March 8, 2026, for evaluation to determine if the procurement will be competitive.
Interested organizations may submit their capabilities and qualifications to perform the effort in writing to the identified point of contact not later than 3:00 p. m. central standard time on 8 3 2026. Such capabilities qualifications will be evaluated solely for the purpose of determining whether or not to conduct this procurement on a competitive basis.
Thermogravimetry- Differential Scanning Calorim - IRA FUNDED - NOTICE: The U. S. Department of Energy ( DOE) National Energy TechnologyLaboratory ( NETL) is issuing the following Brand Name Exact Match Request for Quote ( RFQ) for a Mettler Toledo Laboratory Thermal Gravimetric Analyzer ( TGA) and Diff
This is a brand name exact match RFQ for a Mettler Toledo Laboratory Thermal Gravimetric Analyzer (TGA) and Differential Scanning Calorimeter (DSC). The requirement is a total small business set aside. Quotes must be submitted electronically through FedConnect by the due date indicated in the RFQ. Evaluation will be based on the small business quotation that is technically acceptable with the lowest firm fixed price. Vendors must be approved and authorized resellers. Questions must be submitted via FedConnect within 5 business days of issuance.
Vendors shall submit descriptive literature detailing features, technical capabilities and warranty data, as necessary. Vendors shall submit descriptive literature detailing features, technical capabilities and warranty data, as necessary.
Selection will be based on the small business quotation that is considered technically acceptable with the lowest firm fixed price quote. Selection will be based on the small business quotation that is considered technically acceptable with the lowest firm fixed price quote.
The vendor shall be an approved and authorized reseller of the brand manufacturer as of the submission date of their quote. The vendor shall be an approved and authorized reseller of the brand manufacturer as of the submission date of their quote.
Any quote that is submitted by a contractor that is not a small business concern will not be considered for award. Any quote that is submitted by a contractor that is not a small business concern will not be considered for award.
Primers and probes - NAMRU SOUTH requests approval to award the purchase of primers and probes for protocol & ldquo; The Global Travelers Diarrhea ( GTD) Study: an evaluation of study design and laboratory methodologies standardization in a multisite protocol assessing t
Primers and probes for Global Travelers Diarrhea ( GTD) study 2 units hlt f ttc cca ccg gat cac caa, 2 units hlt r caa cct tgt ggt gca tga tga, 2 units lt pro 5 atto550n ctt gga gag aag aac cct mgbnfq, 2 units sth f gctaaaccagyagrgtcttcaaaa, 2 units sth r cccggtacargcaggattacaaca, 2 units sth pro 5sun tggtcctgaaagcatgaa 3mgbmgbnfq, 2 units stp f tgaatcacttgactcttcaaaa, 2 units stp r ggcaggattacaacaaagtt, 2 units stp pro 56fam tgaacaacacattttactgct 3mgb nfq, 2 units virb f gga ttt gtg caa cga ctt gtt aag, 2 units virb r gag gaa tct tgg ctt tga taa agg, 2 units virb pro 56fam cac tcc att ctg gta ata a mgbnfq, 2 units aggr 333f cag cga tac att aag acg cct aaa g, 2 units aggr 448 r cgt cag cat cag cta caa tta ttc c, 2 units aggr pro fam ctt gca gtt gtc cga att mgbnfq, 2 units eae f ccg att cct ctg gtg acg a, 2 units eae r cca cgg ttt atc aaa ctg ata acg, 2 units eae pro 5 atto550n icy3 cgt cat ggt acg ggt aa mgbnfq, 4 units bfpa fw ggt ctg tct ttg att gaa tct gca, 4 units bfpa rv gca gac tgg tag taa aac atc aca c
AI helper
Purchase of primers and probes for the Global Travelers Diarrhea (GTD) study. All room temperature items. 6 months warranty for manufacture defects.
Add keywords for your products or services. Smart Search helps catch related opportunities beyond exact matches.
2
Start the trial and receive alerts
Use the 14-day free trial and get email alerts with documents or official posting links.
3
Tune your feed
Adjust keywords, regions, email schedule and email style. Use map view and filters when you want to explore.
What our users say
All bids related to our product are captured by you and sent to us. In my opinion, it’s perfect—broad coverage and easy searches across the bid documents.
R. M. Ferreira
They deliver on their promises. The information is simple and straightforward.
G. G
They provide information on a wide and varied range of purchasing processes. All the necessary details are also included.
J. M. Defelitto
Very good and accurate information about the tenders: consistent and precise.
G. R. Ortiz
Excellent information. Just what I was looking for.
We selected the most helpful reviews from real users. Order may change periodically.
I consistently received notifications about bids within the specific segment I chose to monitor. The system simplifies processes that used to be complex, offering a navigation experience that is easy, fast, and modern.
G. P. da S. E. Guimaraes
I closed deals thanks to the information gathered by the search tool. There’s no need to research across multiple media outlets.
J. Comunale
The information helps me submit my bids on time for bids, and I also have readily available information on upcoming bids. So far, I am very satisfied with what I have received.
M. A. Z. Armenta
The idea of ​​using a keyword and sending the information by email is very good.
U. Solutions
The tool is truly effective at scanning bid documents, efficiently delivering bids.
G. D. Reis
It encompasses all portals in one place.
G. Ferrea
Fast, flexible, and simple.
E. Disruptivas
Practicality, speed, trust, and credibility—that’s what the work conveys. The information is precise and sharply targeted.
N. De Lima
It helps me identify areas of opportunity and find bids related to my work area.
I. J. R. Beltran
You see a lot of tenders; you get emails with the alerts.
M. Camarasa
It’s easy to stay connected to bids across multiple municipalities at the same time. Bids are easy to view.
A. P. e S. L. Epp
Excellent platform to help promote and expand the reach of your work.
C. Merino
They notify me promptly when a contest is published.
BidHits is a government bid search engine that monitors official portals and brings relevant federal, state and local opportunities into one place. You can search on the site and receive scheduled email alerts.
Enter your email and activate the trial. For 14 days you can use the main features, including alerts and access to results. When it ends, if you do not subscribe at /subscription.php, the bid list becomes limited and you will not be charged automatically.
1) Add keywords that describe what you sell. 2) Start the trial. 3) Adjust regions, delivery times and email style after signup.
Whenever possible, yes. Some official portals require login or block direct links; in those cases we point you to the official process page so you can download the documents.
Yes. You can filter by region, procurement method, dates and value ranges. You can also save preferences for future alerts and searches.
Yes. In the dashboard you can see bids on a map and use it to plan follow-up by location.
It can happen. Smart Search uses your keywords to find related opportunities, not only exact matches. Add specific terms and remove off-topic results to improve future alerts.
Yes. You can query bids via API. Documentation at /api_integration.php. Ideal for CRM, BI and automations.
In Settings you can pause alerts or adjust delivery times. If you want to delete your account, just contact us. During the free trial there is no auto-charge.
We monitor major official sources every day at the federal, state and local levels. New bid notices are added as soon as they are captured from the source portal.
Plans start at $ 43.00 per month, with options for different business needs and billing terms. Start with a free trial and evaluate the results before subscribing, with no automatic billing.
Add what you sell, get scheduled alerts, open documents or the official page, and use filters by region and method.
Transcript
Welcome to BidHits.
Finding public tenders and bids is important. But what really matters is quickly identifying the opportunities that match what your company sells.
To get started, enter a few keywords that describe your products or services. BidHits shows relevant opportunities, highlights your keywords, and organizes everything by date.
Smart search is already enabled and uses artificial intelligence to expand your results, even when the tender uses different words from the ones you searched for.
For each opportunity, you can view a summary, access documents, mark it as a favorite, add private notes, remove what is not relevant, or view it on the map.
You can also use filters, run searches, and explore the day's opportunities directly on the map.
Start using BidHits now. It's fast, practical, and you can try it for free.
AI Assistant
Ask me about the bid...
Loading summary...
Methodology
Unaided survey with 1084 active users, conducted through 08/13/2026.
Single question: "Would you recommend our services to a friend or colleague?" - 90% answered "yes".
